During polynucleotide synthesis by the foll. enzymes , in which case elongation occurs in 5'-3' direction ? DNA Polymerase RNA Polymerase Reverse Trancriptase All

Md Ariful Islam

0 like 0 dislike
1 views
Share with your friends

1 Answers

Md Ariful Islam

Call
All these polymerases add new bases to the 3' end of existing strands. That is, they synthesize in a 5'-to-3' direction by extending a strand base-paired to the template
0 like 0 dislike
1 views
Talk Doctor Online in Bissoy App
Template-dependent DNA synthesis takes place during DNA replication.what are the requirements for a DNA strand to act as template?

DNA strands may act as templates only during specialphase of cell cycle called S-phase, so cell should be in that phase of growth. To perform replication itself, a huge number...

1 Answers 1 views
Outline steps involved in DNA synthesis at the replication fork. How do DNA polymerase correct their mistakes?

Proofreading is a mechanism by which DNA polymerase corrects replication mistakes. Enzyme recognizes imperfection between newly paired nucleotides, deletes the last nucleotide and adds the correct one. As a result...

1 Answers 1 views
The enzyme responsible for initiating DNA replication in prokaryotes is: 1. DNA polymerase I 2. DNA polymerase III 3. Polymerase beta 4. Primase

The initiation of the replication process is done by the primase. The primase synthesizes RNA primer for DNA polymerase III, so it can begin the replication process. The right answer...

1 Answers 1 views
The binding of ________ is required for transcription to start. 1. a protein 2. DNA polymerase 3. RNA polymerase 4. a transcription factor

3. RNA polymerase.RNA polymerase is an enzyme that synthesises RNA using DNA as a template. As a result, the transcription (synthesis of RNA) cannot begin without RNA polymerase.

1 Answers 1 views
during elongation occuring in translation the enzyme which catalyses the synthesis of peptide bond is

The peptidyl transferase is an aminoacyltransferase (EC 2.3. 2.12) as well as the primary enzymatic function of the ribosome, which forms peptide bonds between adjacent amino acids using tRNAs during...

1 Answers 1 views
(b) For the given DNA coding sequence, generate an RNA sequence. DNA Sequence: CGATGCCTCGCTAGAGGCTCGAAAGCTCTTTCGGAGATAATCG RNA Sequence: String Parenthesis Representation: Arch Diagram:

An RNA sequence only differs from a DNA sequence by a changes in T for U base. From that DNA sequence the RNA sequence will be as follow.GCUACGGAGCGAUCUCCGAGCUUUCGAGAAAGCCUCUAUUAGCFrom this DNA...

1 Answers 1 views
Examine the differences between DNA and RNA. Explain why DNA is the most favorable molecule for genetic material and how RNA compares to it in this respect.

1. DNA is a double helix, with two chains bonded together and twisted, and RNA is a single helical molecule,with only one chain twisted. 2. DNA has the base Thymine...

1 Answers 1 views
where does the RNA-dependent RNA-polymerase to make the first strand of positive sense RNA come from?

The RNA-dependent RNA-polymerase to make the first strand of positive sense RNA come from cytoplasm.

1 Answers 1 views
1 What is the difference between dna ligase dna pol I and dna pol delta 2 does okazaki fragments joining begin during replication or after the end of elongation of replication?!

1. DNA ligase is an enzyme that catalyzes the formation of a phosphodiester bond between two DNA strands joining them together. DNA ligase is present in eukaryotes and prokaryotes and...

1 Answers 1 views
Explain the nucleotide structure and main features of the following nucleic acids: • DNA – stages and enzymes involved in DNA replication • RNA – mRNA, tRNA, rRNA, siRNA

There are three main steps to DNA replication: initiation, elongation, and termination. In order to fit within a cell's nucleus, DNA is packed into tightly coiled structures called chromatin, which...

1 Answers 1 views
X