Examine the differences between DNA and RNA. Explain why DNA is the most favorable molecule for genetic material and how RNA compares to it in this respect.

Md Ariful Islam

0 like 0 dislike
1 views
Share with your friends

1 Answers

Md Ariful Islam

Call
1. DNA is a double helix, with two chains bonded together and twisted, and RNA is a single helical molecule,with only one chain twisted. 2. DNA has the base Thymine (T) but not Uracil (U); RNA has U but not T. 3. DNA contains the pentose sugar deoxyribose; RNA contains the pentose sugar ribose. RNA molecules are very unstable. One of the causes is that its ribose has hydroxy group (OH-) at the 2'-position, at which different chemical oxidizing agents can be added. It is a risk for genetic information which has to be stored very carefully. That is why DNA is more suitable. Moreover, availability of 2 chains in DNA allows to repair information based on the complementarity rule.
0 like 0 dislike
1 views
Talk Doctor Online in Bissoy App
2.3) Tabulate four differences between DNA replication and RNA transcription.

DNA is a double-stranded molecule, while RNA is a single-stranded molecule.DNA and RNA base pairing is slightly different since DNA uses the bases adenine, thymine, cytosine, and guanine; RNA uses...

1 Answers 1 views
(b) For the given DNA coding sequence, generate an RNA sequence. DNA Sequence: CGATGCCTCGCTAGAGGCTCGAAAGCTCTTTCGGAGATAATCG RNA Sequence: String Parenthesis Representation: Arch Diagram:

An RNA sequence only differs from a DNA sequence by a changes in T for U base. From that DNA sequence the RNA sequence will be as follow.GCUACGGAGCGAUCUCCGAGCUUUCGAGAAAGCCUCUAUUAGCFrom this DNA...

1 Answers 1 views
what causes the differences between DNA and RNA structure?

Deoxyribonucleic acid and ribonucleic acid carry all cell genetic information. But there are differences in structure and the compound, which makes them different.So the main difference is structure come from:...

1 Answers 1 views
How long can grapevine be under the most favorable conditions?

Grapevines are long termplants that can live between 50 to 100 years. Because certain favourable conditions permit theelimination of severe forms of major virus diseases etc.

1 Answers 1 views
Does RNA serve as the genetic material of some plants and animals other than viruses?

No, currently known cellular forms of life (Plants, Animals, Fungi, Bacteria, Archaea) use only DNA to store genetic information and transfer it to the next generations. RNA here plays a...

1 Answers 1 views
where does the RNA-dependent RNA-polymerase to make the first strand of positive sense RNA come from?

The RNA-dependent RNA-polymerase to make the first strand of positive sense RNA come from cytoplasm.

1 Answers 1 views
Part of one strand of a DNA molecule was found to have the following base sequence; G-T-C-A-G-T What is the sequence on m-RNA strand copied from this DNA portion?

C-A-G-U-C-A

1 Answers 1 views
Suggest and explain how the genetic make-up of the seedling compares with that of the parent plant

Plant breeders want to produce plants that are homozygous that carry the same trait on both chromosomes. When such plants are bred, they will pass the trait, such as pest...

1 Answers 1 views
Explain why mitosos is necessary to coordinate distribution of genetic material in eukaryotic cells compared to prokaryotic ones.

Mitosis is the most important cellular process for dividing cells. The genetic information in the eukaryotic nuclei must be accurately transmitted to daughter cells by the mitotic spindle, which is...

1 Answers 1 views
Do you think more genetic variation would help a species survive, or do you think less genetic variation would help a species survive? Why?

Because natural selection acts directly only on phenotypes, more genetic variation within a population usually enables more phenotypic variation.Genetic variation is advantageous because it enables some individuals and, therefore, a...

1 Answers 1 views
X