1 Answers
Call
2.2) The DNA strand that is replicated continuously is called the... <ol><li>Primary strand.</li><li>First strand.</li><li>Leading strand.</li><li>Alpha strand.</li><li>Lagging strand.</li></ol>
3.Leading strand
1 Answers 1 views
(b) For the given DNA coding sequence, generate an RNA sequence. DNA Sequence: CGATGCCTCGCTAGAGGCTCGAAAGCTCTTTCGGAGATAATCG RNA Sequence: String Parenthesis Representation: Arch Diagram:
An RNA sequence only differs from a DNA sequence by a changes in T for U base. From that DNA sequence the RNA sequence will be as follow.GCUACGGAGCGAUCUCCGAGCUUUCGAGAAAGCCUCUAUUAGCFrom this DNA...
1 Answers 1 views
Examine the differences between DNA and RNA. Explain why DNA is the most favorable molecule for genetic material and how RNA compares to it in this respect.
1. DNA is a double helix, with two chains bonded together and twisted, and RNA is a single helical molecule,with only one chain twisted. 2. DNA has the base Thymine...
1 Answers 1 views
Explain how the structure of each DNA template strand informs the structure of each newly replicated DNA strand
The sequence of nucleotides in the template DNA strand strictly determines the sequence of nucleotides in the replicated DNA strand. The rigor of the construction of the nucleotides of the...
1 Answers 1 views
How does DNA get copied into each of our cells and what happens if there is an error during this process
DNA gets copied to each new cell during cell division by "DNA Replication".When there is an error during DNA replication, a "mutation" occurs. Incorrectly paired nucleotides that still remain following...
1 Answers 1 views
where does the RNA-dependent RNA-polymerase to make the first strand of positive sense RNA come from?
The RNA-dependent RNA-polymerase to make the first strand of positive sense RNA come from cytoplasm.
1 Answers 1 views
The mRNA strand produced in the nucleus is complementary to the template strand of the DNA and a copy of the coding strand. Explain this:
The RNA product is complementary to the template strand and is almost identical to the other DNA strand, called the nontemplate (or coding) strand.If the gene that's transcribed encodes a...
1 Answers 1 views
From the sequence of RNA -C, U, A, C, A- what would you expect the complement strand of DNA to be?
A-U-C-A-C
1 Answers 1 views