1 Answers
Call
Talk Doctor Online in Bissoy App
4. How might similarities and differences in genetic codes, or the proteins built as a result of these codes, be used to determine how closely related different species are?
The universality of the genetic code is generally regarded by biologists as definitive evidence in favor of the theory of universal common descent. Proteins with the same three-dimensional structure need...
1 Answers 1 views
. How might similarities and differences in genetic codes, or the proteins built as a result of these codes, be used to determine how closely related different species are?
The level of similarities in nucleotides sequenceof genome between different species may say how close they are.
1 Answers 1 views
How are self-replicating molecules, such as RNA molecules in the “RNA World” hypothesis, essential to the most popular hypotheses about the origin of life on Earth?
One of the most popular hypothesis about the origin of life on Earth is the process of appearance of the self-replicative molecules of RNA. Scientists suggest that RNA was first...
1 Answers 1 views
(b) For the given DNA coding sequence, generate an RNA sequence. DNA Sequence: CGATGCCTCGCTAGAGGCTCGAAAGCTCTTTCGGAGATAATCG RNA Sequence: String Parenthesis Representation: Arch Diagram:
An RNA sequence only differs from a DNA sequence by a changes in T for U base. From that DNA sequence the RNA sequence will be as follow.GCUACGGAGCGAUCUCCGAGCUUUCGAGAAAGCCUCUAUUAGCFrom this DNA...
1 Answers 1 views
How might similarities and differences in genetic codes, or the proteins built as a result of these codes, be used to determine how closely related different species are?
One way that researchers assessed protein similarities was by harnessing the immune system's ability to recognize foreign proteins. For example, the immune system of a rabbit will recognize a human...
1 Answers 1 views
Which polypeptide is coded for by the mRNA sequence 5’-GCU-GAA-GUC-GAG-GUG-UGG-3’?
|-C- N-terminus - terminus b
1 Answers 1 views
what is the translation ?
Why did the raisin go out with the plum?
Because he couldn’t find a CTA-CGC-TGA-CTC.
mRNA transcript: GAU GCG ACU GAG
Translation:
Translation is a process of synthesis of protein using mRNA as a template. Each codon (three nucleotides) corresponds to a certain amino acid that is included into the protein. The...
1 Answers 1 views
where does the RNA-dependent RNA-polymerase to make the first strand of positive sense RNA come from?
The RNA-dependent RNA-polymerase to make the first strand of positive sense RNA come from cytoplasm.
1 Answers 1 views
1 What is the difference between dna ligase dna pol I and dna pol delta
2 does okazaki fragments joining begin during replication or after the end of elongation of replication?!
1. DNA ligase is an enzyme that catalyzes the formation of a phosphodiester bond between two DNA strands joining them together. DNA ligase is present in eukaryotes and prokaryotes and...
1 Answers 1 views
<ol><li>Change GAG CGC GTC GCA TGG GGG AAT into the following:</li></ol>-RNA d -RNA t -Amino acid
RNA d: CUC GCG CAG CGU ACC CCC UUARNA t: GAG CGC GUC GCA UGG GGG AAUAmino acid: glu - arg - val - ala - trp - gly -...
1 Answers 1 views